version
PlantPromoterDB promoter information of AT2G37690

Summary of Gene (AT2G37690)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G37690  TAIR      NCBI 
Gene model AT2G37690  
Description phosphoribosylaminoimidazole carboxylase, putative / AIR carboxylase, putative; FUNCTIONS IN: phosphoribosylaminoimidazole carboxylase activity, catalytic activity, ATP binding; INVOLVED IN: 'de novo' IMP biosynthetic process, pollen development; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Phosphoribosylaminoimidazole carboxylase (InterPro:IPR016301), PreATP-grasp-like fold (InterPro:IPR016185), ATP-grasp fold, ATP-dependent carboxylate-amine ligase-type (InterPro:IPR003135), 1-(5-Phosphoribosyl)-5-amino-4-imidazole-carboxylate (AIR) carboxylase (InterPro:IPR000031), Phosphoribosylaminoimidazole carboxylase, ATPase subunit (InterPro:IPR005875), ATP-grasp fold (InterPro:IPR011761), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), Rudiment single hybrid motif (InterPro:IPR011054), Pre-ATP-grasp fold (InterPro:IPR013817); BEST Arabidopsis thaliana protein match is: phosphoribosylaminoimidazole carboxylase family protein / AIR carboxylase family protein (TAIR:AT2G05140.1); Has 11552 Blast hits to 11539 proteins in 1440 species: Archae - 286; Bacteria - 6042; Metazoa - 132; Fungi - 152; Plants - 33; Viruses - 0; Other Eukaryotes - 4907 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15805111-15806310)

Genome position     
from initiation codon
AT2G37690.1         
TSS from cDNA
TSS information
AT2G37690                        5'->3' (+)
Promoter sequence

 
AT2G37680.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G37690

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+15805723-388

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-15805559AT2G37680.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACCGAACCGGGT-1580561115805624AT2G37680.1
 AtREG568AAACCGAA       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG455      AACCGGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTAAG-1580562615805633AT2G37680.1
 AtREG605CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGAAAACCGGA-1580566615805674AT2G37680.1
 AtREG542AAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAAACGC-1580568015805687AT2G37680.1
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGTCTGACGG-1580572115805728AT2G37680.1
 AtREG622TCTGACGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.