version
PlantPromoterDB promoter information of AT2G38000.1

Summary of Gene (AT2G38000.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G38000  TAIR      NCBI 
Gene model AT2G38000.1  
Description chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15906276-15905077)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G38000.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G38000.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC8-15905357-81

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15905371-95
TSS cloneAclone-15905364-88
TSS cloneAclone-15905359-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTC-1590537415905381-98-105
Y PatchTTTCTTCTT-1590539215905400-116-124
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGACCCGACCCGA-1590542715905439-151-163
 AtREG617TGACCCGA      PPDB Motif  PLACE Motif 
 AtREG390 GACCCGAC     PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405  ACCCGACC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   CCCGACCC   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375    CCGACCCG  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383     CGACCCGA PPDB Motif  PLACE Motif 
REGGACCCGGTT-1590545115905459-175-183
 AtREG463GACCCGGT  PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG455 ACCCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCACACGTGGCAAT-1590546515905478-189-202
 AtREG588TCACACGT      ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTG     ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382  ACACGTGG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367   CACGTGGC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379    ACGTGGCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452     CGTGGCAA  PPDB Motif  PLACE MotifGCCAC 
 AtREG654      GTGGCAAT PPDB Motif  PLACE MotifGCCAC 
REGCAAAACGCG-1590556315905571-287-295
 AtREG585CAAAACGC  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG566 AAAACGCG PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.