version
PlantPromoterDB promoter information of AT2G39810.1

Summary of Gene (AT2G39810.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G39810  TAIR      NCBI 
Gene model AT2G39810.1  
Description A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress.  
#
#

Overview

Focused view (chromosome 2: 16611941-16613140)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G39810.1                      5'->3' (+)
Promoter sequence

 
AT2G39805.1         
AT2G39805.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G39810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+16612805-136
TSS clone peakCclone+16612836-105

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-16612489AT2G39805.1, AT2G39805.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-16612554AT2G39805.1, AT2G39805.2
TSS cloneTclone-16612515AT2G39805.1, AT2G39805.2
TSS cloneCclone-16612498AT2G39805.1, AT2G39805.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTCCT-1661251516612524AT2G39805.1, AT2G39805.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAGCGCGTG-1661254316612551AT2G39805.1, AT2G39805.2
 AtREG492AAGCGCGT  PPDB MotifACGCGC  PLACE Motif 
 AtREG381 AGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGAGCGCGTGT-1661257016612578AT2G39805.1, AT2G39805.2
 AtREG381AGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG385 GCGCGTGT PPDB MotifACGCGC  PLACE MotifACACNNG 
REGTCACGTGTCC-1661258916612598AT2G39805.1, AT2G39805.2
 AtREG628TCACGTGT  DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366 CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG472  ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGTCTGGGCCCAAG-1661260716612618AT2G39805.1, AT2G39805.2
 AtREG397TCTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG363 CTGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   GGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505    GGCCCAAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATATGGGCCTTTG-1661265016612662AT2G39805.1, AT2G39805.2
 AtREG432ATATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359    GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG656     GGCCTTTG PPDB Motif  PLACE Motif 
REGTTCGGGTCAAA-1661266916612679AT2G39805.1, AT2G39805.2
 AtREG597TTCGGGTC    PPDB MotifGGGACCC  PLACE Motif 
 AtREG617 TCGGGTCA   PPDB Motif  PLACE Motif 
 AtREG592   GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTCTGGGCCCAAG-1661269416612705AT2G39805.1, AT2G39805.2
 AtREG397TCTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG363 CTGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   GGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505    GGCCCAAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATATGGGCCTTT-1661273816612749AT2G39805.1, AT2G39805.2
 AtREG432ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359    GGGCCTTT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTCGGGTCAAA-1661275616612766AT2G39805.1, AT2G39805.2
 AtREG597TTCGGGTC    PPDB MotifGGGACCC  PLACE Motif 
 AtREG617 TCGGGTCA   PPDB Motif  PLACE Motif 
 AtREG592   GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.