version
PlantPromoterDB promoter information of AT2G40810.1

Summary of Gene (AT2G40810.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G40810  TAIR      NCBI 
Gene model AT2G40810.1  
Description AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 17031686-17032885)

Genome position     
from initiation codon
AT2G40810.2         
TSS from cDNA
TSS information
AT2G40810.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G40810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+17032477-209

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+17032477-209
TSS cloneAclone+17032478-208

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGGCACG+1703223017032240-456-446
 AtREG531AAAACGGC    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG522   ACGGCACG PPDB Motif  PLACE Motif 
REGAAAACGACACG+1703226117032271-425-415
 AtREG520AAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428   ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGAGACACGTGA+1703230017032309-386-377
 AtREG470AGACACGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366 GACACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG628  ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGCCCAATAG+1703233517032342-351-344
 AtREG624CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGTTAGCCCATTAT+1703236717032378-319-308
 AtREG571TTAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581 TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546    CCCATTAT PPDB Motif  PLACE Motif 
REGAACCGACT+1703239017032397-296-289
 AtREG641AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGTTAAACCGGA+1703241517032424-271-262
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.