version
PlantPromoterDB promoter information of AT2G41945.3

Summary of Gene (AT2G41945.3)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G41945  TAIR      NCBI 
Gene model AT2G41945.3  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  
#
#

Overview

Focused view (chromosome 2: 17513898-17512699)

Genome position     
from initiation codon
AT2G41945.1         
AT2G41945.2         
TSS from cDNA
TSS information
AT2G41945.3                      5'->3' (-)
Promoter sequence










 
AT2G41950.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G41945.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-17512955-57
TSS peakA4-17512947-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-17512954-56
TSS cloneTclone-17512953-55
TSS cloneGclone-17512946-48
TSS cloneTclone-17512940-42
TSS cloneGclone-17512934-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATAAGGCCCAGTA-1751299317513012-95-114
 AtREG376AAAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394   GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG425       ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351        TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353         AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410          AGGCCCAG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384           GGCCCAGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG434            GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCA-1751302017513029-122-131
 AtREG421ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGATGACGT-1751303917513046-141-148
 AtREG578GATGACGTABA PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.