PlantPromoterDB promoter information of AT2G42220

Summary of Gene (AT2G42220)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G42220  TAIR      NCBI 
Gene model AT2G42220  
Description rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 686 Blast hits to 686 proteins in 102 species: Archae - 12; Bacteria - 169; Metazoa - 1; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  


Focused view (chromosome 2: 17589005-17590204)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT2G42220                        5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT2G42220

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA30+17592089-16

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneAclone+17592057-48
TSS cloneCclone+17592064-41
TSS cloneCclone+17592075-30
TSS cloneCclone+17592086-19
TSS cloneAclone+17592089-16
TSS cloneCclone+17592100-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCT+1759016517590172AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4

REG information

TypeSequenceAnnotationGenome positionGene model
REGTAAATGGGCTA+1759010017590110AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
REGATAATGGGCCCTAAGAGGCCCACA+1759011217590135AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
 AtREG546ATAATGGG                 PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG387     GGGCCCTA            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG411             AGAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAATTGGGCTTT+1759015717590168AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.