version
PlantPromoterDB promoter information of AT2G42220

Summary of Gene (AT2G42220)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G42220  TAIR      NCBI 
Gene model AT2G42220  
Description rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 686 Blast hits to 686 proteins in 102 species: Archae - 12; Bacteria - 169; Metazoa - 1; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 17589705-17590904)

Genome position     
from initiation codon
AT2G42210.1         
AT2G42210.2         
AT2G42210.3         
AT2G42210.4         
TSS from cDNA
TSS information
AT2G42220                        5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G42220

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA30+17592089-16

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17592057-48
TSS cloneCclone+17592064-41
TSS cloneCclone+17592075-30
TSS cloneCclone+17592086-19
TSS cloneAclone+17592089-16
TSS cloneCclone+17592100-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGTGGCAAT+1759198417591994-121-111
 AtREG413TACGTGGC    PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452  CGTGGCAA  PPDB Motif  PLACE MotifGCCAC 
 AtREG654   GTGGCAAT PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA10+17590212AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+17590213AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
TSS cloneAclone+17590223AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
TSS cloneCclone+17590241AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
TSS cloneTclone+17590244AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
TSS cloneTclone+17590247AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
TSS cloneGclone+17590276AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCT+1759016517590172AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAATGGGCTA+1759010017590110AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAATGGGCCCTAAGAGGCCCACA+1759011217590135AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
 AtREG546ATAATGGG                 PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391   ATGGGCCC              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400    TGGGCCCT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387     GGGCCCTA            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG411             AGAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447              GAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482               AGGCCCAC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612                GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAATTGGGCTTT+1759015717590168AT2G42210.1, AT2G42210.2, AT2G42210.3, AT2G42210.4
 AtREG600TAATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.