PlantPromoterDB promoter information of AT2G42310.1

Summary of Gene (AT2G42310.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G42310  TAIR      NCBI 
Gene model AT2G42310.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57785.1); Has 77 Blast hits to 77 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 32; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  


Focused view (chromosome 2: 17619901-17621100)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT2G42310.1                      5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT2G42310.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA51+17625225-26

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneTclone+17625211-40
TSS cloneCclone+17625215-36
TSS cloneTclone+17625216-35
TSS cloneCclone+17625222-29
TSS cloneAclone+17625225-26
TSS cloneCclone+17625226-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 AtREG451  GGTTCGGT    PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGATAAAGCCCAATAGGCCCAATT+1762106617621087AT2G42300.1, AT2G42300.2
 AtREG601ATAAAGCC               PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC              PPDB MotifGCCCA  PLACE Motif 
 AtREG355     GCCCAATA          PPDB MotifGCCCA  PLACE Motif 
 AtREG624      CCCAATAG         PPDB MotifGCCCA  PLACE Motif 
 AtREG424         AATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362          ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG418              GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.