version
PlantPromoterDB promoter information of AT2G43650

Summary of Gene (AT2G43650)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G43650  TAIR      NCBI 
Gene model AT2G43650  
Description EMBRYO DEFECTIVE 2777 (EMB2777); FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28230.2); Has 13418 Blast hits to 9203 proteins in 531 species: Archae - 65; Bacteria - 1866; Metazoa - 4566; Fungi - 1730; Plants - 522; Viruses - 165; Other Eukaryotes - 4504 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 18098430-18099629)

Genome position     
from initiation codon
AT2G43650.1         
TSS from cDNA
TSS information
AT2G43650                        5'->3' (+)
Promoter sequence

 
AT2G43640.1         
AT2G43640.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G43650

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+18099238-192
TSS clone peakTclone+18099241-189
TSS cloneGclone+18099253-177

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-18099109AT2G43640.1, AT2G43640.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-18099111AT2G43640.1, AT2G43640.2
TSS cloneGclone-18099109AT2G43640.1, AT2G43640.2
TSS cloneAclone-18099090AT2G43640.1, AT2G43640.2
TSS cloneCclone-18099058AT2G43640.1, AT2G43640.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAGCCCATAT-1809915718099168AT2G43640.1, AT2G43640.2
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477   AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTACTGGGCCTAATAAGGCCCATTAT-1809917618099200AT2G43640.1, AT2G43640.2
 AtREG434TACTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG384 ACTGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410  CTGGGCCT                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506     GGCCTAAT             PPDB Motif  PLACE Motif 
 AtREG425           ATAAGGCC       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351            TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353             AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354              AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361               GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357                GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546                 CCCATTAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.