version
PlantPromoterDB promoter information of AT2G45740.3

Summary of Gene (AT2G45740.3)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G45740  TAIR      NCBI 
Gene model AT2G45740.3  
Description member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.  
#
#

Overview

Focused view (chromosome 2: 18838865-18840064)

Genome position     
from initiation codon
AT2G45740.1         
AT2G45740.2         
TSS from cDNA
TSS information
AT2G45740.3                      5'->3' (+)
Promoter sequence





 
AT2G45730.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G45740.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+18839639-226

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+18839586-279
TSS cloneTclone+18839588-277
TSS cloneTclone+18839590-275
TSS cloneTclone+18839640-225
TSS cloneGclone+18839642-223
TSS cloneCclone+18839643-222
TSS cloneGclone+18839678-187

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCTCT+1883966018839671-205-194
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCACGTGGAA+1883934818839359-517-506
 AtREG547ATCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG627    ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGTGCCACGTGGT+1883938618839397-479-468
 AtREG444GTGCCACG     PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG544    CACGTGGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAACGACGT+1883953718839544-328-321
 AtREG493AACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGAAGCCCTA+1883958218839589-283-276
 AtREG651AAGCCCTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-18839152AT2G45730.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-18839145AT2G45730.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTT-1883913018839138AT2G45730.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTAACCG-1883923618839243AT2G45730.1
 AtREG645TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTAAACCG-1883925118839258AT2G45730.1
 AtREG473TTAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGCCTTAA-1883926918839276AT2G45730.1
 AtREG416GGCCTTAA PPDB Motif  PLACE Motif 
REGTAAATGGGCT-1883928518839294AT2G45730.1
 AtREG443TAAATGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAAAGCCCAATAA-1883930418839317AT2G45730.1
 AtREG545TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGTTCCACGTGGAT-1883934818839359AT2G45730.1
 AtREG627TTCCACGT     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG547    ACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGACCACGTGGCAC-1883938618839397AT2G45730.1
 AtREG544ACCACGTG    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG367  CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444    CGTGGCAC PPDB Motif  PLACE MotifGCCAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.