version
PlantPromoterDB promoter information of AT2G46330.1

Summary of Gene (AT2G46330.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G46330  TAIR      NCBI 
Gene model AT2G46330.1  
Description Encodes arabinogalactan protein (AGP16).  
#
#

Overview

Focused view (chromosome 2: 19020108-19018909)

Genome position     
from initiation codon
AT2G46330.2         
TSS from cDNA
TSS information
AT2G46330.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G46330.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG34-19019247-139

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-19019255-147
TSS cloneAclone-19019254-146
TSS cloneCclone-19019253-145
TSS cloneTclone-19019245-137
TSS cloneAclone-19019140-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTACTATAA-1901928319019290-175-182
Y PatchTTTCTCTCTCTCCTCC-1901921119019226-103-118
Y PatchTTCCTCTC-1901923419019241-126-133
Y PatchTCTCCTTC-1901925619019263-148-155
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTAACCGGTC-1901929519019305-187-197
 AtREG645TTTAACCG    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503  TAACCGGT  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG552   AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGGT-1901931019019317-202-209
 AtREG436AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAACCGGT-1901932019019328-212-220
 AtREG548ATAACCGG  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.