version
PlantPromoterDB promoter information of AT2G46505.1

Summary of Gene (AT2G46505.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G46505  TAIR      NCBI 
Gene model AT2G46505.1  
Description Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion.  
#
#

Overview

Focused view (chromosome 2: 19091468-19090269)

Genome position     
from initiation codon
AT2G46510.1         
TSS from cDNA
TSS information
AT2G46505.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G46505.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA51-19090537-69

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-19090546-78
TSS cloneAclone-19090535-67
TSS cloneTclone-19090534-66
TSS cloneCclone-19090503-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCTC-1909049319090500-25-32
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAGTATAAAGCCCAACT-1909059019090613-122-145
 AtREG409AAAAGCCC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG434    GCCCAGTA             PPDB MotifGCCCA  PLACE Motif 
 AtREG601           ATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365            TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG407              AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574               AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607                GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCTTC-1909062519090635-157-167
 AtREG474GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.