version
PlantPromoterDB promoter information of AT2G47110.1

Summary of Gene (AT2G47110.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G47110  TAIR      NCBI 
Gene model AT2G47110.1  
Description polyubiquitin gene  
#
#

Overview

Focused view (chromosome 2: 19343701-19344900)

Genome position     
from initiation codon
AT2G47100           
AT2G47100.1         
TSS from cDNA
TSS information
AT2G47110.1                      5'->3' (+)
Promoter sequence






 
AT2G47090.1         
AT2G47100.1         
AT2G47115.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G47110.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA113+19344668-33

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+19344649-52
TSS cloneCclone+19344666-35
TSS cloneCclone+19344667-34
TSS cloneAclone+19344668-33
TSS cloneGclone+19344669-32
TSS cloneTclone+19344673-28
TSS cloneTclone+19344686-15

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTC+1934463919344647-62-54
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATTGGG+1934442219344429-279-272
 AtREG509ATATTGGG PPDB Motif  PLACE Motif 
REGAAAAGGCCTTTGAAGCCCAATG+1934452919344550-172-151
 AtREG459AAAAGGCC               PPDB Motif  PLACE Motif 
 AtREG656    GGCCTTTG           PPDB Motif  PLACE Motif 
 AtREG476           GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407            AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402             AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461              GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGAGGGGTAATTACG+1934457419344586-127-115
 AtREG642AGGGGTAA      PPDB MotifACCCCT  PLACE Motif 
 AtREG646     TAATTACGABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.