version
PlantPromoterDB promoter information of AT2G47400.1

Summary of Gene (AT2G47400.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G47400  TAIR      NCBI 
Gene model AT2G47400.1  
Description CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The annotation of this gene is based on article 32494.  
#
#

Overview

Focused view (chromosome 2: 19445889-19447088)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G47400.1                      5'->3' (+)
Promoter sequence






 
AT2G47390.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G47400.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA46+19446857-32

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+19446816-73
TSS cloneTclone+19446838-51
TSS cloneAclone+19446841-48
TSS cloneTclone+19446842-47
TSS cloneTclone+19446844-45
TSS cloneCclone+19446850-39
TSS cloneTclone+19446852-37
TSS cloneAclone+19446857-32
TSS cloneAclone+19446858-31
TSS cloneCclone+19446860-29
TSS cloneTclone+19446869-20
TSS cloneCclone+19446871-18
TSS cloneTclone+19446873-16
TSS cloneAclone+19446886-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTC+1944683319446840-56-49
Y PatchTTCTCCTCC+1944686319446871-26-18
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTACACGTGGCAA+1944674919446761-140-128
 AtREG562GTACACGT     ABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG453 TACACGTG    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG382  ACACGTGG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367   CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379    ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452     CGTGGCAA PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-19446365AT2G47390.1
TSS clone peakAclone-19446331AT2G47390.1
TSS cloneAclone-19446258AT2G47390.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.