version
PlantPromoterDB promoter information of AT2G47780

Summary of Gene (AT2G47780)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G47780  TAIR      NCBI 
Gene model AT2G47780  
Description rubber elongation factor (REF) protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) family protein (TAIR:AT3G05500.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 19569076-19570275)

Genome position     
from initiation codon
AT2G47770.1         
AT2G47780.1         
TSS from cDNA
TSS information
AT2G47780                        5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G47780

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+19570053-23

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+19570049-27
TSS cloneAclone+19570056-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGCTT+1956980219569809-274-267
 AtREG608CGTGGCTTABA PPDB Motif  PLACE MotifGCCAC 
REGCGACACGTGTT+1956983619569846-240-230
 AtREG478CGACACGT   ABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366 GACACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG590   CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGCCATTAAG+1956985619569863-220-213
 AtREG604CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGATGCCACGTGGCT+1956996719569979-109-97
 AtREG448ATGCCACG     ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTGGC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG450     ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.