version
PlantPromoterDB promoter information of AT3G01400.1

Summary of Gene (AT3G01400.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G01400  TAIR      NCBI 
Gene model AT3G01400.1  
Description armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT5G58680.1); Has 3812 Blast hits to 2325 proteins in 207 species: Archae - 0; Bacteria - 2; Metazoa - 1580; Fungi - 356; Plants - 1453; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 150920-152119)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G01400.1                      5'->3' (+)
Promoter sequence





 
AT3G01390.1         
AT3G01390.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G01400.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+151786-134

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+151793-127
TSS cloneAclone+151795-125

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCTCT+151774151785-146-135
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGCCCA+151580151587-340-333
 AtREG422TGGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGAAGCCCATTC+151603151613-317-307
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG643   GCCCATTC PPDB MotifGCCCA  PLACE Motif 
REGATAATGGG+151616151623-304-297
 AtREG546ATAATGGG PPDB Motif  PLACE Motif 
REGAAAAAGCCCAAA+151634151645-286-275
 AtREG589AAAAAGCC     PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAATGGG+151677151684-243-236
 AtREG546ATAATGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-151531AT3G01390.1, AT3G01390.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-151529AT3G01390.1, AT3G01390.2
TSS cloneTclone-151528AT3G01390.1, AT3G01390.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTTCTCTCTT-151496151512AT3G01390.1, AT3G01390.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGGCCCA-151580151587AT3G01390.1, AT3G01390.2
 AtREG422TGGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGAATGGGCTTC-151603151613AT3G01390.1, AT3G01390.2
 AtREG643GAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCCCATTAT-151616151623AT3G01390.1, AT3G01390.2
 AtREG546CCCATTAT PPDB Motif  PLACE Motif 
REGTTTGGGCTTTTT-151634151645AT3G01390.1, AT3G01390.2
 AtREG469TTTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376  TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409   GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589    GGCTTTTT PPDB Motif  PLACE Motif 
REGCCCATTAT-151677151684AT3G01390.1, AT3G01390.2
 AtREG546CCCATTAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.