version
PlantPromoterDB promoter information of AT3G01780

Summary of Gene (AT3G01780)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G01780  TAIR      NCBI 
Gene model AT3G01780  
Description Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position.  
#
#

Overview

Focused view (chromosome 3: 278171-279370)

Genome position     
from initiation codon
AT3G01780.1         
TSS from cDNA
TSS information
AT3G01780                        5'->3' (+)
Promoter sequence







 
AT3G01770.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G01780

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+279100-71

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+279060-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTTCC+279071279082-100-89
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCCGTTTT+278801278810-370-361
 AtREG497ACGCCGTT   PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524 CGCCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531  GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTACTGGGC+278813278820-358-351
 AtREG434TACTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGGGCTTAT+278901278909-270-262
 AtREG426TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462 GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTAAAGCCCAATG+278914278925-257-246
 AtREG365TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461    GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGTTATTGGG+278943278950-228-221
 AtREG417TTATTGGG PPDB MotifGCCCA  PLACE Motif 
REGACGGCACG+278968278975-203-196
 AtREG522ACGGCACG PPDB Motif  PLACE Motif 
REGACGGCACGCGCTT+278999279011-172-160
 AtREG522ACGGCACG      PPDB Motif  PLACE Motif 
 AtREG381    CACGCGCT  PPDB MotifACGCGC  PLACE Motif 
 AtREG492     ACGCGCTT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-278785AT3G01770.1
TSS cloneGclone-278782AT3G01770.1
TSS clone peakGclone-278780AT3G01770.1
TSS cloneCclone-278778AT3G01770.1
TSS cloneGclone-278776AT3G01770.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAGCCCA-278901278909AT3G01770.1
 AtREG462ATAAGCCC  PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCATTGGGCTTTA-278914278925AT3G01770.1
 AtREG461CATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA PPDB MotifGCCCA  PLACE Motif 
REGCCCAATAA-278943278950AT3G01770.1
 AtREG417CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCGTGCCGT-278968278975AT3G01770.1
 AtREG522CGTGCCGT PPDB Motif  PLACE Motif 
REGAAGCGCGTGCCGT-278999279011AT3G01770.1
 AtREG492AAGCGCGT      PPDB MotifACGCGC  PLACE Motif 
 AtREG381 AGCGCGTG     PPDB MotifACGCGC  PLACE Motif 
 AtREG522     CGTGCCGT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.