version
PlantPromoterDB promoter information of AT3G01910.2

Summary of Gene (AT3G01910.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G01910  TAIR      NCBI 
Gene model AT3G01910.2  
Description Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.  
#
#

Overview

Focused view (chromosome 3: 316391-315192)

Genome position     
from initiation codon
AT3G01910.1         
AT3G01910.3         
TSS from cDNA
TSS information
AT3G01910.2                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G01910.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA60-317312-671
TSS peakA2-317017-376

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-317315-674
TSS cloneTclone-317314-673
TSS cloneCclone-317313-672
TSS cloneAclone-317312-671
TSS cloneAclone-317311-670
TSS cloneTclone-317310-669
TSS cloneTclone-317307-666
TSS cloneTclone-317299-658
TSS cloneGclone-317296-655
TSS cloneTclone-317293-652

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTC-316973316982-332-341
Y PatchTCTCCTCCTC-317284317293-643-652
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCTTAG-317063317070-422-429
 AtREG577GGCCTTAG PPDB Motif  PLACE Motif 
REGCGTCATTT-317302317309-661-668
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGAAAACGACGCCGTT-317362317375-721-734
 AtREG520AAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG      PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC     PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC    PPDB Motif  PLACE Motif 
 AtREG540     GACGCCGT  PPDB Motif  PLACE Motif 
 AtREG497      ACGCCGTT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGGTTTGGGCTCAATTTGGGCTC-317410317430-769-789
 AtREG474GTTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   TTTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC   TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421           ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
REGTAGGGCTT-317598317605-957-964
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.