version
PlantPromoterDB promoter information of AT3G01920.1

Summary of Gene (AT3G01920.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G01920  TAIR      NCBI 
Gene model AT3G01920.1  
Description yrdC family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sua5/YciO/YrdC/YwlC (InterPro:IPR004388), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945), Sua5/YciO/YrdC, N-terminal (InterPro:IPR006070); BEST Arabidopsis thaliana protein match is: yrdC protein-related (TAIR:AT5G60590.2); Has 4590 Blast hits to 4590 proteins in 1207 species: Archae - 120; Bacteria - 2917; Metazoa - 115; Fungi - 50; Plants - 35; Viruses - 0; Other Eukaryotes - 1353 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 316449-317648)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G01920.1                      5'->3' (+)
Promoter sequence

 
AT3G01910.1         
AT3G01910.2         
AT3G01910.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G01920.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+317444-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA60-317312AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS peakA2-317017AT3G01910.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-317315AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneTclone-317314AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneCclone-317313AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneAclone-317312AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneAclone-317311AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneTclone-317310AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneTclone-317307AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneTclone-317299AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneGclone-317296AT3G01910.1, AT3G01910.2, AT3G01910.3
TSS cloneTclone-317293AT3G01910.1, AT3G01910.2, AT3G01910.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTC-316973316982AT3G01910.2
Y PatchTCTCCTCCTC-317284317293AT3G01910.1, AT3G01910.2, AT3G01910.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCTTAG-317063317070AT3G01910.2
 AtREG577GGCCTTAG PPDB Motif  PLACE Motif 
REGCGTCATTT-317302317309AT3G01910.2
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGAAAACGACGCCGTT-317362317375AT3G01910.1, AT3G01910.2, AT3G01910.3
 AtREG520AAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG      PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC     PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC    PPDB Motif  PLACE Motif 
 AtREG540     GACGCCGT  PPDB Motif  PLACE Motif 
 AtREG497      ACGCCGTT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGGTTTGGGCTCAATTTGGGCTC-317410317430AT3G01910.1, AT3G01910.2, AT3G01910.3
 AtREG474GTTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   TTTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC   TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421           ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
REGTAGGGCTT-317598317605AT3G01910.1, AT3G01910.2, AT3G01910.3
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.