version
PlantPromoterDB promoter information of AT3G02080

Summary of Gene (AT3G02080)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02080  TAIR      NCBI 
Gene model AT3G02080  
Description 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 366161-364962)

Genome position     
from initiation codon
AT3G02080.1         
TSS from cDNA
TSS information
AT3G02080                        5'->3' (-)
Promoter sequence








 
AT3G02090.1         
AT3G02090.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02080

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA130-365242-81

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-365245-84
TSS cloneCclone-365244-83
TSS cloneTclone-365243-82
TSS cloneGclone-365241-80
TSS cloneTclone-365238-77
TSS cloneCclone-365234-73
TSS cloneGclone-365232-71
TSS cloneGclone-365220-59
TSS cloneCclone-365216-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATATAAG-365269365279-108-118
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTGACCC-365318365325-157-164
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTGGGCTGA-365341365348-180-187
 AtREG609TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATTAGGCCCATTAG-365351365364-190-203
 AtREG506ATTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGGTAAGGCC-365374365381-213-220
 AtREG530GTAAGGCC PPDB Motif  PLACE Motif 
REGATAAGGCC-365432365439-271-278
 AtREG425ATAAGGCC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGTGTCGTTTA-365466365476-305-315
 AtREG599GGTGTCGT    PPDB Motif  PLACE Motif 
 AtREG527 GTGTCGTT  DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569  TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565   GTCGTTTA PPDB Motif  PLACE Motif 
REGAAAACGACGTCATTT-365496365510-335-349
 AtREG520AAAACGAC        PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG       PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT      PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTC     PPDB MotifACGT  PLACE MotifACGT 
 AtREG657       CGTCATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+365514AT3G02090.1, AT3G02090.2
TSS cloneGclone+365529AT3G02090.1, AT3G02090.2
TSS cloneTclone+365553AT3G02090.1, AT3G02090.2
TSS cloneTclone+365555AT3G02090.1, AT3G02090.2
TSS clone peakTclone+365557AT3G02090.1, AT3G02090.2
TSS clone peakAclone+365561AT3G02090.1, AT3G02090.2
TSS cloneTclone+365562AT3G02090.1, AT3G02090.2
TSS cloneAclone+365604AT3G02090.1, AT3G02090.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGTCAAA+365318365325AT3G02090.1, AT3G02090.2
 AtREG592GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTCAGCCCA+365341365348AT3G02090.1, AT3G02090.2
 AtREG609TCAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTAATGGGCCTAAT+365351365364AT3G02090.1, AT3G02090.2
 AtREG558CTAATGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506      GGCCTAAT PPDB Motif  PLACE Motif 
REGGGCCTTAC+365374365381AT3G02090.1, AT3G02090.2
 AtREG530GGCCTTAC PPDB Motif  PLACE Motif 
REGGGCCTTAT+365432365439AT3G02090.1, AT3G02090.2
 AtREG425GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAAACGACACC+365466365476AT3G02090.1, AT3G02090.2
 AtREG565TAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG599   ACGACACC PPDB Motif  PLACE Motif 
REGAAATGACGTCGTTTT+365496365510AT3G02090.1, AT3G02090.2
 AtREG657AAATGACG        PPDB Motif  PLACE Motif 
 AtREG431    GACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG493     ACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG415      CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520       GTCGTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.