version
PlantPromoterDB promoter information of AT3G02190.1

Summary of Gene (AT3G02190.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02190  TAIR      NCBI 
Gene model AT3G02190.1  
Description 60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 407342-406143)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G02190.1                      5'->3' (-)
Promoter sequence







 
AT3G02200.1         
AT3G02200.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02190.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-406396-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCCTTATAAAAA-406427406438-85-96
Y PatchTTCTTCCTC-406413406421-71-79
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCAACGGTC-406461406470-119-128
 AtREG554TCCAACGG   PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG553  CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGTCTGACGG-406491406498-149-156
 AtREG622TCTGACGG PPDB Motif  PLACE Motif 
REGACGGTTTAC-406502406510-160-168
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG519 CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAACCGGAA-406532406540-190-198
 AtREG621TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534 AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTCCGGTTAAA-406543406554-201-212
 AtREG644TTTCCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501   CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645    CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTCCGGTTT-406676406683-334-341
 AtREG521TCCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG17+406602AT3G02200.1, AT3G02200.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+406596AT3G02200.1, AT3G02200.2
TSS cloneTclone+406598AT3G02200.1, AT3G02200.2
TSS cloneGclone+406602AT3G02200.1, AT3G02200.2
TSS cloneTclone+406603AT3G02200.1, AT3G02200.2
TSS cloneTclone+406605AT3G02200.1, AT3G02200.2
TSS cloneTclone+406607AT3G02200.1, AT3G02200.2
TSS cloneCclone+406609AT3G02200.1, AT3G02200.2
TSS cloneGclone+406619AT3G02200.1, AT3G02200.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAGAG+406563406570AT3G02200.1, AT3G02200.2
Y PatchTTTCTTCTCTCTCTCTT+406585406601AT3G02200.1, AT3G02200.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAGCGTTT+406378406385AT3G02200.1, AT3G02200.2
 AtREG626CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGACCGTTGGA+406461406470AT3G02200.1, AT3G02200.2
 AtREG553GACCGTTG  Auxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG554  CCGTTGGA PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGCCGTCAGA+406491406498AT3G02200.1, AT3G02200.2
 AtREG622CCGTCAGA PPDB Motif  PLACE Motif 
REGGTAAACCGT+406502406510AT3G02200.1, AT3G02200.2
 AtREG519GTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGTTCCGGTTA+406532406540AT3G02200.1, AT3G02200.2
 AtREG534TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621 TCCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTTAACCGGAAA+406543406554AT3G02200.1, AT3G02200.2
 AtREG645TTTAACCG     PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621  TAACCGGA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534   AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644    ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.