version
PlantPromoterDB promoter information of AT3G02460.1

Summary of Gene (AT3G02460.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02460  TAIR      NCBI 
Gene model AT3G02460.1  
Description plant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 505110-506309)

Genome position     
from initiation codon
AT3G02460.2         
TSS from cDNA
TSS information
AT3G02460.1                      5'->3' (+)
Promoter sequence





 
AT3G02450.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02460.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+505654-456

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+505434-676

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTC+505678505685-432-425
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATTA+505417505424-693-686
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGATAAAGCC+505475505482-635-628
 AtREG601ATAAAGCC PPDB Motif  PLACE Motif 
REGACGGCGTCGTTTC+505589505601-521-509
 AtREG540ACGGCGTC      PPDB Motif  PLACE Motif 
 AtREG537  GGCGTCGT    PPDB Motif  PLACE Motif 
 AtREG439   GCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415    CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576     GTCGTTTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-505209AT3G02450.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-505230AT3G02450.1
TSS cloneGclone-505170AT3G02450.1
TSS cloneAclone-505147AT3G02450.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTT-505197505204AT3G02450.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCAATG-505275505282AT3G02450.1
 AtREG461GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGAAAAGGCCCATG-505305505316AT3G02450.1
 AtREG459AAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504    GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGAGCCCAATAG-505319505328AT3G02450.1
 AtREG402AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355 GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624  CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCCAAAA-505337505348AT3G02450.1
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469   AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGG-505417505424AT3G02450.1
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGGGCTTTAT-505475505482AT3G02450.1
 AtREG601GGCTTTAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.