version
PlantPromoterDB promoter information of AT3G02710

Summary of Gene (AT3G02710)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02710  TAIR      NCBI 
Gene model AT3G02710  
Description Encodes a protein with a putative role in mRNA splicing.  
#
#

Overview

Focused view (chromosome 3: 582184-583383)

Genome position     
from initiation codon
AT3G02710.1         
TSS from cDNA
TSS information
AT3G02710                        5'->3' (+)
Promoter sequence





 
AT3G02700.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02710

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+583116-68

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+583113-71
TSS cloneAclone+583168-16

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGACTTT+582961582968-223-216
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTTGACCC+582975582982-209-202
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTAAACGACACC+583032583042-152-142
 AtREG565TAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG599   ACGACACC PPDB Motif  PLACE Motif 
REGCATTGGGCCTCA+583050583061-134-123
 AtREG461CATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG447   TGGGCCTC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG587    GGGCCTCA PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG18-582905AT3G02700.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-582905AT3G02700.1
TSS cloneTclone-582867AT3G02700.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTCTCT-582861582873AT3G02700.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGTCAA-582961582968AT3G02700.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGGGTCAAA-582975582982AT3G02700.1
 AtREG592GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGGGTGTCGTTTA-583032583042AT3G02700.1
 AtREG599GGTGTCGT    PPDB Motif  PLACE Motif 
 AtREG527 GTGTCGTT  DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569  TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565   GTCGTTTA PPDB Motif  PLACE Motif 
REGTGAGGCCCAATG-583050583061AT3G02700.1
 AtREG587TGAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461    GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTTTT-583086583098AT3G02700.1
 AtREG421ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589     GGCTTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.