version
PlantPromoterDB promoter information of AT3G04770.2

Summary of Gene (AT3G04770.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G04770  TAIR      NCBI 
Gene model AT3G04770.2  
Description 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 1311846-1310647)

Genome position     
from initiation codon
AT3G04770.1         
AT3G04780.1         
TSS from cDNA
TSS information
AT3G04770.2                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G04770.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-1310887-41
TSS clone peakAclone-1310880-34
TSS cloneGclone-1310877-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCTTGAAAGCCCATTTA-13109331310955-87-109
 AtREG529TTTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525   TGGGCTTG             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376           AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378            AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372             AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386              GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443               CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCT-13109701310978-124-132
 AtREG529TTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTATTGGG-13110221311029-176-183
 AtREG417TTATTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.