version
PlantPromoterDB promoter information of AT3G06590

Summary of Gene (AT3G06590)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06590  TAIR      NCBI 
Gene model AT3G06590  
Description transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2056312-2055113)

Genome position     
from initiation codon
AT3G06590.1         
AT3G06590.2         
TSS from cDNA
TSS information
AT3G06590                        5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G06590

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA73-2055407-95

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2055416-104
TSS cloneTclone-2055413-101
TSS cloneCclone-2055406-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATATATCT-20554372055449-125-137
Y PatchCTTTCTTC-20553882055395-76-83
Y PatchTCTTCCTCTTCTTCTCC-20554232055439-111-127
Y PatchCCTCTCTCCC-20554482055457-136-145
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCGTT-20554892055496-177-184
 AtREG377GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
REGAAAACGACGCC-20555232055533-211-221
 AtREG520AAAACGAC    PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG   PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC  PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.