version
PlantPromoterDB promoter information of AT3G06670.1

Summary of Gene (AT3G06670.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06670  TAIR      NCBI 
Gene model AT3G06670.1  
Description binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2114136-2112937)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G06670.1                      5'->3' (-)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G06670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-2113383-247

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2113394-258
TSS cloneGclone-2113381-245
TSS cloneAclone-2113366-230

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCTCTCTTCTCTCTTCTT-21134002113423-264-287
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGGGTATT-21134992113508-363-372
 AtREG570TAAGGGTA   PPDB MotifACCCT  PLACE Motif 
 AtREG623 AAGGGTAT  PPDB MotifACCCT  PLACE Motif 
 AtREG567  AGGGTATT PPDB MotifACCCT  PLACE Motif 
REGGGCCTTTT-21135282113535-392-399
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 
REGAGCGCGTG-21135492113556-413-420
 AtREG381AGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGCGAACCGACT-21135682113577-432-441
 AtREG575CGAACCGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG641  AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGTGTCGTTTT-21135872113595-451-459
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520 GTCGTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.