version
PlantPromoterDB promoter information of AT3G06770

Summary of Gene (AT3G06770)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06770  TAIR      NCBI 
Gene model AT3G06770  
Description glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2133816-2132617)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G06770                        5'->3' (-)
Promoter sequence

 
AT3G06760.1         
AT3G06760.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G06770

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-2137334-718
TSS peakG5-2137122-506

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2137129-513
TSS cloneTclone-2136977-361
TSS cloneGclone-2136962-346

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTTCTTCTTCTCTCTCTCTCTCTCTCT-21371232137156-507-540
Y PatchTCCTTCTCCTTCT-21371602137172-544-556
Y PatchCTTTCTTCT-21373032137311-687-695
Y PatchTCTTCTTCCTTC-21373212137332-705-716
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATTAA-21375232137530-907-914
 AtREG396CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+2132780AT3G06760.1, AT3G06760.2
TSS peakA4+2132808AT3G06760.1, AT3G06760.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+2132837AT3G06760.1, AT3G06760.2
TSS cloneCclone+2132840AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132857AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132895AT3G06760.1, AT3G06760.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCC+21328272132837AT3G06760.1, AT3G06760.2
Y PatchTTTCTCTCTCTCTC+21328432132856AT3G06760.1, AT3G06760.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACACGTGTGA+21326292132639AT3G06760.1, AT3G06760.2
 AtREG453TACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG460  CACGTGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCCAAACCGCGTGAAACGAC+21326832132701AT3G06760.1, AT3G06760.2
 AtREG550CCAAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG441   AACCGCGT        Drought PPDB Motif  PLACE Motif 
 AtREG502     CCGCGTGA      Drought PPDB Motif  PLACE Motif 
 AtREG631      CGCGTGAA     Drought PPDB Motif  PLACE Motif 
 AtREG576           GAAACGAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.