version
PlantPromoterDB promoter information of AT3G07300.3

Summary of Gene (AT3G07300.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G07300  TAIR      NCBI 
Gene model AT3G07300.3  
Description eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2328380-2327181)

Genome position     
from initiation codon
AT3G07300.1         
AT3G07300.2         
AT3G07310.1         
TSS from cDNA
TSS information
AT3G07300.3                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G07300.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2327626-246
TSS clone peakGclone-2327624-244
TSS cloneCclone-2327579-199

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTC-23275952327604-215-224
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGCCCAAAA-23276822327693-302-313
 AtREG427TTCGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCTTATTTTAGGCCCAAAT-23277042327728-324-348
 AtREG529TTTTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462    GGGCTTAT              PPDB MotifGCCCA  PLACE Motif 
 AtREG430            TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360             TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358              TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356               AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373                GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421                 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTGGGTCCCA-23277742327782-394-402
 AtREG615TGGGTCCC ABA PPDB MotifGGGACCC  PLACE Motif 
 AtREG596 GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.