version
PlantPromoterDB promoter information of AT3G07630.1

Summary of Gene (AT3G07630.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G07630  TAIR      NCBI 
Gene model AT3G07630.1  
Description Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  
#
#

Overview

Focused view (chromosome 3: 2434457-2435656)

Genome position     
from initiation codon
AT3G07630.2         
TSS from cDNA
TSS information
AT3G07630.1                      5'->3' (+)
Promoter sequence










 
AT3G07620.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G07630.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2435450-7
TSS clone peakTclone+2435454-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCAT+24354232435430-34-27
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCTTTTATTGGGCCCAGT+24352672435288-190-169
 AtREG651TAGGGCTT               PPDB Motif  PLACE Motif 
 AtREG409  GGGCTTTT             PPDB MotifGCCCA  PLACE Motif 
 AtREG549   GGCTTTTA            PPDB Motif  PLACE Motif 
 AtREG417        TTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355         TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352          ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392           TTGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422            TGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG363             GGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384              GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTATGGGCCTTAG+24353342435346-123-111
 AtREG394TTATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG577     GGCCTTAG PPDB Motif  PLACE Motif 
REGGTGGCCCATCA+24353862435396-71-61
 AtREG445GTGGCCCA    PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
 AtREG490 TGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403  GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG635   GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.