version
PlantPromoterDB promoter information of AT3G08510.1

Summary of Gene (AT3G08510.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G08510  TAIR      NCBI 
Gene model AT3G08510.1  
Description Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  
#
#

Overview

Focused view (chromosome 3: 2586556-2585357)

Genome position     
from initiation codon
AT3G08510.2         
AT3G08510.3         
TSS from cDNA
TSS information
AT3G08510.1                      5'->3' (-)
Promoter sequence








 
AT3G08520.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G08510.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-2585736-180

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2585810-254
TSS cloneTclone-2585794-238
TSS cloneTclone-2585762-206
TSS cloneAclone-2585735-179
TSS cloneTclone-2585618-62

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAATAA-25858542585866-298-310
 AtREG409AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCTTAATGGGCTTTAT-25858732585887-317-331
 AtREG604CTTAATGG        PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365      GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601       GGCTTTAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC2+2585950AT3G08520.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+2585942AT3G08520.1
TSS cloneAclone+2585985AT3G08520.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCGTCGTTTT+25856872585696AT3G08520.1
 AtREG648TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520  GTCGTTTT PPDB Motif  PLACE Motif 
REGTTATTGGGCTTTT+25858542585866AT3G08520.1
 AtREG417TTATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGATAAAGCCCATTAAG+25858732585887AT3G08520.1
 AtREG601ATAAAGCC        PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604       CCATTAAG PPDB Motif  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.