version
PlantPromoterDB promoter information of AT3G08610.1

Summary of Gene (AT3G08610.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G08610  TAIR      NCBI 
Gene model AT3G08610.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2617768-2616569)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G08610.1                      5'->3' (-)
Promoter sequence










 
AT3G08620.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G08610.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA94-2616795-27

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2616822-54
TSS cloneGclone-2616817-49
TSS cloneTclone-2616815-47
TSS cloneAclone-2616795-27
TSS cloneCclone-2616794-26
TSS cloneAclone-2616793-25
TSS cloneAclone-2616792-24

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAAAAGCCCATTAT-26168632616882-95-114
 AtREG476GAAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529   GCCCAAAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG409       AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376        AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372          AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357           GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546            CCCATTAT PPDB Motif  PLACE Motif 
REGTATTGGGCTTTG-26169052616916-137-148
 AtREG355TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559    GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAA-26169352616942-167-174
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+2617768AT3G08620.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.