version
PlantPromoterDB promoter information of AT3G08720.2

Summary of Gene (AT3G08720.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G08720  TAIR      NCBI 
Gene model AT3G08720.2  
Description Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.  
#
#

Overview

Focused view (chromosome 3: 2651407-2650208)

Genome position     
from initiation codon
AT3G08720.1         
TSS from cDNA
TSS information
AT3G08720.2                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G08720.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-2651160-753
TSS clone peakAclone-2650985-578
TSS clone peakTclone-2650843-436

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGATATAAATT-26510092651018-602-611
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGACACG-26509952651002-588-595
 AtREG428ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGTTGACTTT-26510522651059-645-652
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGCACGCGCC-26511842651191-777-784
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGAACACGTGTCC-26512372651247-830-840
 AtREG590AACACGTG   ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366  CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG472   ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGGTTCGGTTTCCCAATAG-26512542651270-847-863
 AtREG556GTTCGGTT          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568 TTCGGTTT         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG624         CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGGCCCACTA-26512842651291-877-884
 AtREG532GCCCACTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.