version
PlantPromoterDB promoter information of AT3G09200

Summary of Gene (AT3G09200)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G09200  TAIR      NCBI 
Gene model AT3G09200  
Description 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 2826020-2824821)

Genome position     
from initiation codon
AT3G09200.1         
AT3G09200.2         
AT3G09210.1         
TSS from cDNA
TSS information
AT3G09200                        5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G09200

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA28-2825088-68

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-2825114-94
TSS cloneTclone-2825093-73
TSS cloneTclone-2825091-71
TSS cloneTclone-2825090-70
TSS cloneAclone-2825088-68
TSS cloneCclone-2825087-67
TSS cloneGclone-2825086-66
TSS cloneTclone-2825085-65
TSS cloneAclone-2825039-19

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATAAAAC-28251162825125-96-105
Y PatchCTCTCTCT-28250732825080-53-60
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCTAGA-28251552825162-135-142
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGACCGTTAG-28251822825189-162-169
 AtREG603ACCGTTAG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCCGTCAGA-28252142825221-194-201
 AtREG622CCGTCAGA PPDB Motif  PLACE Motif 
REGAAAAGGCCCAACA-28252302825242-210-222
 AtREG459AAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449    GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543     GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGTAAATGGGCCTAAT-28252482825261-228-241
 AtREG443TAAATGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506      GGCCTAAT PPDB Motif  PLACE Motif 
REGAACGACGACGT-28252982825308-278-288
 AtREG648AACGACGA    PPDB Motif  PLACE Motif 
 AtREG526   GACGACGT PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.