version
PlantPromoterDB promoter information of AT3G10050.1

Summary of Gene (AT3G10050.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G10050  TAIR      NCBI 
Gene model AT3G10050.1  
Description first enzyme in the biosynthetic pathway of isoleucine  
#
#

Overview

Focused view (chromosome 3: 3102741-3101542)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G10050.1                      5'->3' (-)
Promoter sequence






 
AT3G10060.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G10050.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-3101797-56
TSS clone peakGclone-3101761-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT-31017483101755-7-14
Y PatchCTTCTTCCTCTCT-31017623101774-21-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAACCGGTC-31018163101826-75-85
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+3102053AT3G10060.1
TSS peakA4+3102224AT3G10060.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+3102170AT3G10060.1
TSS cloneAclone+3102224AT3G10060.1
TSS cloneAclone+3102225AT3G10060.1
TSS cloneGclone+3102226AT3G10060.1
TSS cloneGclone+3102232AT3G10060.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACCGGTTTGG+31018163101826AT3G10060.1
 AtREG552GACCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.