version
PlantPromoterDB promoter information of AT3G10572.1

Summary of Gene (AT3G10572.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G10572  TAIR      NCBI 
Gene model AT3G10572.1  
Description 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3303346-3304545)

Genome position     
from initiation codon
AT3G10570.1         
TSS from cDNA
TSS information
AT3G10572.1                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G10572.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+3304274-72

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+3304271-75
TSS cloneAclone+3304275-71
TSS cloneAclone+3304290-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCC+33042403304248-106-98
Y PatchCTTCTTCCTC+33042533304262-93-84
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCATTAA+33041253304136-221-210
 AtREG437ATGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490 TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTTTTGGGCTTAG+33041623304173-184-173
 AtREG529TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634    GGGCTTAG PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCATTATATTGGCCCAATAG+33042003304224-146-122
 AtREG476GAAGCCCA                  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA               PPDB MotifGCCCA  PLACE Motif 
 AtREG546    CCCATTAT              PPDB Motif  PLACE Motif 
 AtREG446            ATTGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484             TTGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420              TGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352               GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624                 CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGAAATACCC+33042263304233-120-113
 AtREG602AAATACCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.