version
PlantPromoterDB promoter information of AT3G11250.1

Summary of Gene (AT3G11250.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G11250  TAIR      NCBI 
Gene model AT3G11250.1  
Description 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3520453-3521652)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G11250.1                      5'->3' (+)
Promoter sequence







 
AT3G11240.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G11250.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+3521407-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+3521390-63
TSS cloneAclone+3521406-47
TSS cloneGclone+3521420-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTC+35213703521377-83-76
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACACG+35211963521204-257-249
 AtREG527AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428 ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGACGTCACGCGTGT+35212293521241-224-212
 AtREG489ACGTCACG     ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG536     ACGCGTGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGATTTGGGCCTAAT+35212523521264-201-189
 AtREG421ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506     GGCCTAAT PPDB Motif  PLACE Motif 
REGTTAAAGCCCAATT+35212703521282-183-171
 AtREG545TTAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418     GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCCGTCAGA+35213033521310-150-143
 AtREG622CCGTCAGA PPDB Motif  PLACE Motif 
REGACCGTTAG+35213373521344-116-109
 AtREG603ACCGTTAG PPDB Motif  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-3521115AT3G11240.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-3521115AT3G11240.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCC-35210973521104AT3G11240.1
Y PatchCTTCTTCTCCTTCTTCTTC-35211423521160AT3G11240.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTGTCGTT-35211963521204AT3G11240.1
 AtREG428CGTGTCGT ABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
 AtREG527 GTGTCGTTDREB1Aox PPDB Motif  PLACE Motif 
REGACACGCGTGACGT-35212293521241AT3G11240.1
 AtREG536ACACGCGT     ABA, Drought PPDB Motif  PLACE MotifACACNNG 
 AtREG489     CGTGACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGATTAGGCCCAAAT-35212523521264AT3G11240.1
 AtREG506ATTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421     GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCTTTAA-35212703521282AT3G11240.1
 AtREG418AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA PPDB Motif  PLACE Motif 
REGTCTGACGG-35213033521310AT3G11240.1
 AtREG622TCTGACGG PPDB Motif  PLACE Motif 
REGCTAACGGT-35213373521344AT3G11240.1
 AtREG603CTAACGGT PPDB Motif  PLACE MotifYAACKG, CNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.