version
PlantPromoterDB promoter information of AT3G11710.1

Summary of Gene (AT3G11710.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G11710  TAIR      NCBI 
Gene model AT3G11710.1  
Description ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3706613-3705414)

Genome position     
from initiation codon
AT3G11720.1         
AT3G11720.2         
AT3G11720.3         
TSS from cDNA
TSS information
AT3G11710.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G11710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-3705701-88

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-3705713-100
TSS cloneTclone-3705707-94
TSS cloneAclone-3705701-88
TSS cloneGclone-3705658-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTC-37057023705709-89-96
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAATGGGCTTG-37057593705770-146-157
 AtREG558CTAATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525    TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTAAACCGAATAAGCCCTA-37057763705794-163-181
 AtREG519GTAAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG462         ATAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG651           AAGCCCTA PPDB Motif  PLACE Motif 
REGCAAACCGGTTCGGTTCG-37057983705814-185-201
 AtREG496CAAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528   ACCGGTTC       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CCGGTTCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456     CGGTTCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451      GGTTCGGT    PPDB Motif  PLACE Motif 
 AtREG556       GTTCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575         TCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGAA-37058373705846-224-233
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.