version
PlantPromoterDB promoter information of AT3G11930

Summary of Gene (AT3G11930)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G11930  TAIR      NCBI 
Gene model AT3G11930  
Description universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3779521-3780720)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G11930                        5'->3' (+)
Promoter sequence

 
AT3G11945.1         
AT3G11945.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G11930

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA36+3776331-40

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+3776259-112
TSS cloneGclone+3776327-44
TSS cloneAclone+3776328-43
TSS cloneCclone+3776330-41
TSS cloneAclone+3776331-40
TSS cloneCclone+3776332-39
TSS cloneAclone+3776333-38
TSS cloneTclone+3776338-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAATATAAAAA+37762933776303-78-68
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCGTTTTA+37760743776082-297-289
 AtREG650GGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564 GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAGCCACG+37761133776120-258-251
 AtREG608AAGCCACGABA PPDB Motif  PLACE MotifGCCAC 
REGCACGTGGC+37762523776259-119-112
 AtREG367CACGTGGCABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATCTATATAAAAG-37795303779543AT3G11940.1, AT3G11940.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAGCCCAAAC-37795553779564AT3G11940.1, AT3G11940.2
 AtREG533GAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469 AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474  GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAT-37795813779589AT3G11940.1, AT3G11940.2
 AtREG376AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAAACCGGTTC-37796093779620AT3G11940.1, AT3G11940.2
 AtREG473TTAAACCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528    ACCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAACCGG-37796503779657AT3G11940.1, AT3G11940.2
 AtREG501TTAACCGG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.