version
PlantPromoterDB promoter information of AT3G12390.1

Summary of Gene (AT3G12390.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G12390  TAIR      NCBI 
Gene model AT3G12390.1  
Description nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA3 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3) (TAIR:AT5G13850.1); Has 5006 Blast hits to 2282 proteins in 284 species: Archae - 50; Bacteria - 639; Metazoa - 1963; Fungi - 710; Plants - 330; Viruses - 56; Other Eukaryotes - 1258 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 3941344-3942543)

Genome position     
from initiation codon
AT3G12385           
AT3G12385.1         
TSS from cDNA
TSS information
AT3G12390.1                      5'->3' (+)
Promoter sequence







 
AT3G12380.1         
AT3G12385.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G12390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+3942285-59

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+3942258-86
TSS cloneTclone+3942259-85
TSS cloneTclone+3942262-82
TSS cloneTclone+3942265-79
TSS cloneGclone+3942267-77
TSS cloneTclone+3942305-39
TSS cloneCclone+3942306-38
TSS cloneCclone+3942312-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCC+39422413942248-103-96
Y PatchTCTCTCTCTCTTTC+39422973942310-47-34
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCGCGTGGCTTTTAACCACGTGGC+39420273942051-317-293
 AtREG381AGCGCGTG                  PPDB MotifACGCGC  PLACE Motif 
 AtREG608    CGTGGCTT             ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG549       GGCTTTTA           PPDB Motif  PLACE Motif 
 AtREG544               ACCACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG367                 CACGTGGCABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
REGGGCGTTTT+39420743942081-270-263
 AtREG650GGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGATAAGCCCAAC+39421553942165-189-179
 AtREG462ATAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574   AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
REGTTTTGGGCCTTTT+39422003942212-144-132
 AtREG529TTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359    GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459     GGCCTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.