version
PlantPromoterDB promoter information of AT3G13450

Summary of Gene (AT3G13450)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G13450  TAIR      NCBI 
Gene model AT3G13450  
Description branched chain alpha-keto acid dehydrogenase E1 beta  
#
#

Overview

Focused view (chromosome 3: 4389095-4387896)

Genome position     
from initiation codon
AT3G13460.1         
AT3G13460.2         
AT3G13460.3         
AT3G13460.4         
TSS from cDNA
TSS information
AT3G13450                        5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G13450

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-4385265-970
TSS peakG4-4385154-859
TSS peakG4-4384392-97

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4385242-947
TSS cloneAclone-4384434-139
TSS cloneCclone-4384433-138
TSS cloneCclone-4384424-129

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCC-43843794384386-84-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGACGTGGCT-43844854384495-190-200
 AtREG440CTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388  GACGTGGC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG450   ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGCCCAATAA-43845334384540-238-245
 AtREG417CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGGTGTCGTTTTGA-43845754384586-280-291
 AtREG527GTGTCGTT    DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569 TGTCGTTT    PPDB Motif  PLACE Motif 
 AtREG520  GTCGTTTT   PPDB Motif  PLACE Motif 
 AtREG653    CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC13-4388459AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-4388501AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneTclone-4388492AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneAclone-4388488AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneGclone-4388475AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneTclone-4388473AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneCclone-4388458AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
TSS cloneGclone-4388417AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTCT-43884194388429AT3G13460.1, AT3G13460.2, AT3G13460.3, AT3G13460.4
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAATGGGCCTATT+43890444389056AT3G13470.1
 AtREG357TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424     GGCCTATT PPDB Motif  PLACE Motif 
REGACAGGCCCAAAT+43890744389085AT3G13470.1
 AtREG433ACAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.