version
PlantPromoterDB promoter information of AT3G13920.1

Summary of Gene (AT3G13920.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G13920  TAIR      NCBI 
Gene model AT3G13920.1  
Description eukaryotic translation initiation factor 4A-1  
#
#

Overview

Focused view (chromosome 3: 4595128-4593929)

Genome position     
from initiation codon
AT3G13920.2         
AT3G13920.3         
TSS from cDNA
TSS information
AT3G13920.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G13920.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG85-4594912-784

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-4594962-834
TSS cloneCclone-4594919-791
TSS cloneTclone-4594918-790
TSS cloneTclone-4594916-788
TSS cloneTclone-4594914-786
TSS cloneCclone-4594913-785
TSS cloneGclone-4594912-784
TSS cloneGclone-4594911-783
TSS cloneAclone-4594910-782
TSS cloneTclone-4594909-781
TSS cloneAclone-4594908-780
TSS cloneTclone-4594907-779
TSS cloneCclone-4594902-774
TSS cloneCclone-4594882-754

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGTATATAAACA-45949424594953-814-825
Y PatchCTCTCTCT-45948634594870-735-742
Y PatchCTCTTCTCTT-45948734594882-745-754
Y PatchCCTCTTTC-45949134594920-785-792
Y PatchTTTCTCTC-45949234594930-795-802
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGGTAAAACCGGAAA-45950044595020-876-892
 AtREG642AGGGGTAA          PPDB MotifACCCCT  PLACE Motif 
 AtREG542      AAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521       AAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534        AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644         ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.