version
PlantPromoterDB promoter information of AT3G14110.2

Summary of Gene (AT3G14110.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G14110  TAIR      NCBI 
Gene model AT3G14110.2  
Description Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift.  
#
#

Overview

Focused view (chromosome 3: 4678010-4676811)

Genome position     
from initiation codon
AT3G14110.1         
TSS from cDNA
TSS information
AT3G14110.2                      5'->3' (-)
Promoter sequence




 
AT3G14120.1         
AT3G14120.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G14110.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-4677650-640
TSS peakG4-4677617-607

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4677642-632
TSS cloneAclone-4677641-631
TSS cloneCclone-4677621-611
TSS cloneAclone-4677620-610

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTTCTC-46775684677579-558-569
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGCTGCG-46777594677768-749-758
 AtREG626AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369  ACGCTGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+4677811AT3G14120.1, AT3G14120.2
TSS peakG2+4677817AT3G14120.1, AT3G14120.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+4677814AT3G14120.1, AT3G14120.2
TSS cloneTclone+4677815AT3G14120.1, AT3G14120.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCACGCGG+46775354677542AT3G14120.1, AT3G14120.2
 AtREG502TCACGCGGDrought PPDB Motif  PLACE Motif 
REGCGCAGCGTTT+46777594677768AT3G14120.1, AT3G14120.2
 AtREG369CGCAGCGT   PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.