version
PlantPromoterDB promoter information of AT3G15090.1

Summary of Gene (AT3G15090.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G15090  TAIR      NCBI 
Gene model AT3G15090.1  
Description oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5075597-5076796)

Genome position     
from initiation codon
AT3G15080.1         
TSS from cDNA
TSS information
AT3G15090.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G15090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+5075865-982
TSS peakA5+5076780-67

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+5076689-158
TSS cloneCclone+5076719-128

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCTTTCT+50759025075913-945-934
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTCGGTTTGG+50766265076639-221-208
 AtREG575TCGGTTCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556   GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568    TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550      CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAAACCGGTTAA+50766415076653-206-194
 AtREG519GTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501     CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCTGCCACGTC+50767195076728-128-119
 AtREG468CTGCCACG  ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.