version
PlantPromoterDB promoter information of AT3G15450

Summary of Gene (AT3G15450)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G15450  TAIR      NCBI 
Gene model AT3G15450  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27450.1); Has 270 Blast hits to 270 proteins in 60 species: Archae - 0; Bacteria - 23; Metazoa - 2; Fungi - 2; Plants - 227; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5208600-5209799)

Genome position     
from initiation codon
AT3G15430.1         
AT3G15430.2         
TSS from cDNA
TSS information
AT3G15450                        5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G15450

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA149+5213003-47

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+5212981-69
TSS cloneAclone+5213003-47
TSS cloneTclone+5213004-46
TSS cloneAclone+5213006-44
TSS cloneCclone+5213009-41

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATAAAAC+52129685212979-82-71
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGCAC+52127435212750-307-300
 AtREG444CGTGGCAC PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+5208737AT3G15430.1, AT3G15430.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+5208738AT3G15430.1, AT3G15430.2
TSS cloneAclone+5208744AT3G15430.1, AT3G15430.2
TSS cloneTclone+5208916AT3G15430.1, AT3G15430.2
TSS cloneTclone+5208920AT3G15430.1, AT3G15430.2
TSS cloneGclone+5209020AT3G15430.1, AT3G15430.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTCCGGTTC-52086185208627AT3G15420.1
 AtREG644TTTCCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGAAA+52086185208627AT3G15430.1, AT3G15430.2
 AtREG579GAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644  ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.