version
PlantPromoterDB promoter information of AT3G16990.1

Summary of Gene (AT3G16990.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G16990  TAIR      NCBI 
Gene model AT3G16990.1  
Description TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 5797783-5796584)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G16990.1                      5'->3' (-)
Promoter sequence











 
AT3G17000.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G16990.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5796790-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCAC-57968785796885-95-102
 AtREG466CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTTAAAGCCCAATG-57968935796905-110-122
 AtREG545TTAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461     GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGAATAGGCCTTGGCCCATTAA-57969075796926-124-143
 AtREG424AATAGGCC             PPDB Motif  PLACE Motif 
 AtREG649 ATAGGCCT            PPDB Motif  PLACE Motif 
 AtREG484        TTGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490         TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361          GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357           GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396            CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGCGTGGCGA-57969335796940-150-157
 AtREG471CGTGGCGAABA PPDB Motif  PLACE MotifGCCAC 
REGTGTCACGT-57970005797007-217-224
 AtREG606TGTCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGTGCCACGTAATTA-57970485797061-265-278
 AtREG444GTGCCACG       PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413  GCCACGTA     PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG646      CGTAATTAABA PPDB Motif  PLACE Motif 
REGCGTGACGTG-57970795797087-296-304
 AtREG489CGTGACGT ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG466 GTGACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+5797179AT3G17000.1
TSS cloneTclone+5797186AT3G17000.1
TSS cloneTclone+5797188AT3G17000.1
TSS clone peakAclone+5797199AT3G17000.1
TSS cloneAclone+5797239AT3G17000.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAATGGGCCAAGGCCTATT+57969075796926AT3G17000.1
 AtREG396TTAATGGG             PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484    TGGGCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG649           AGGCCTAT  PPDB Motif  PLACE Motif 
 AtREG424            GGCCTATT PPDB Motif  PLACE Motif 
REGTCGCCACG+57969335796940AT3G17000.1
 AtREG471TCGCCACGABA PPDB Motif  PLACE MotifGCCAC 
REGACGTGACA+57970005797007AT3G17000.1
 AtREG606ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTAATTACGTGGCAC+57970485797061AT3G17000.1
 AtREG646TAATTACG      ABA PPDB Motif  PLACE Motif 
 AtREG413    TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379     ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444      CGTGGCAC PPDB Motif  PLACE MotifGCCAC 
REGCACGTCACG+57970795797087AT3G17000.1
 AtREG466CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489 ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGGTGACGTGGAA+57971065797116AT3G17000.1
 AtREG466GTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG627   ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.