version
PlantPromoterDB promoter information of AT3G17770.1

Summary of Gene (AT3G17770.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G17770  TAIR      NCBI 
Gene model AT3G17770.1  
Description dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT1G48430.1); Has 2619 Blast hits to 2616 proteins in 532 species: Archae - 8; Bacteria - 1790; Metazoa - 84; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 554 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 6086957-6085758)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G17770.1                      5'->3' (-)
Promoter sequence








 
AT3G17780.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G17770.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6086131-174
TSS clone peakCclone-6086029-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCCTCTT-60860126086023-55-66
Y PatchTTTCTCTCT-60860506086058-93-101
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGCCTGGCCCATAT-60861816086199-224-242
 AtREG418AATTGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG619    GGGCCTGG        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG490         TGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364          GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432           GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTCACGTGTT-60862936086301-336-344
 AtREG628TCACGTGT DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590 CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGACGACGT-60863096086316-352-359
 AtREG526GACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGAGCGCGTGGCAC-60863196086330-362-373
 AtREG381AGCGCGTG     PPDB MotifACGCGC  PLACE Motif 
 AtREG444    CGTGGCAC PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+6086913AT3G17780.1
TSS clone peakCclone+6086919AT3G17780.1
TSS cloneAclone+6086948AT3G17780.1
TSS cloneGclone+6086949AT3G17780.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAATTGGGCCGTAAAAAGGCCCATCA+60868376086862AT3G17780.1
 AtREG647CAATTGGG                   PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368    TGGGCCGT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG499     GGGCCGTA              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459             AAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359              AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353               AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354                AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403                 GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG635                  GCCCATCA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.