version
PlantPromoterDB promoter information of AT3G18165.1

Summary of Gene (AT3G18165.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G18165  TAIR      NCBI 
Gene model AT3G18165.1  
Description Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity.  
#
#

Overview

Focused view (chromosome 3: 6222248-6223447)

Genome position     
from initiation codon
AT3G18160.1         
AT3G18160.2         
AT3G18160.3         
TSS from cDNA
TSS information
AT3G18165.1                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G18165.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA34+6223200-48

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+6223188-60
TSS cloneAclone+6223200-48
TSS cloneGclone+6223201-47
TSS cloneTclone+6223205-43
TSS cloneCclone+6223208-40

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTT+62231606223168-88-80
Y PatchTCTTTCTC+62231926223199-56-49
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGG+62231116223150-137-98
 AtREG387TAGGGCCCTA                               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG476          GAAGCCCA                       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA                      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG398                CAAGGCCC                 PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                 AAGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                  AGGCCCAA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                   GGCCCAAT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                    GCCCAATA             PPDB MotifGCCCA  PLACE Motif 
 AtREG417                     CCCAATAA            PPDB MotifGCCCA  PLACE Motif 
 AtREG542                           AAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG455                             AACCGGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG463                              ACCGGGTC   PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG494                               CCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG375                                CGGGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.