version
PlantPromoterDB promoter information of AT3G18270.1

Summary of Gene (AT3G18270.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G18270  TAIR      NCBI 
Gene model AT3G18270.1  
Description a cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model.  
#
#

Overview

Focused view (chromosome 3: 6261010-6262209)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G18270.1                      5'->3' (+)
Promoter sequence









 
AT3G18260.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G18270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+6261922-88

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+6261911-99
TSS cloneTclone+6261923-87
TSS cloneGclone+6261940-70
TSS cloneAclone+6261941-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATTTA+62617266261733-284-277
 AtREG443CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGCCGGTATA+62618126261819-198-191
 AtREG629CCGGTATA PPDB Motif  PLACE Motif 
REGGACCCGAA+62618266261833-184-177
 AtREG597GACCCGAA PPDB MotifGGGACCC  PLACE Motif 
REGCTAAACCGT+62618426261850-168-160
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGTTGAACCGAACCGGTTTAT+62618576261875-153-135
 AtREG640TTGAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC        PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423      CGAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528       GAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436         ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412          CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598           CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.