version
PlantPromoterDB promoter information of AT3G20240

Summary of Gene (AT3G20240)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G20240  TAIR      NCBI 
Gene model AT3G20240  
Description mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SHS1 (SODIUM HYPERSENSITIVE 1); binding / nucleotide transmembrane transporter/ transporter (TAIR:AT4G32400.1); Has 16786 Blast hits to 9647 proteins in 354 species: Archae - 0; Bacteria - 0; Metazoa - 7901; Fungi - 4785; Plants - 2484; Viruses - 0; Other Eukaryotes - 1616 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 7056192-7057391)

Genome position     
from initiation codon
AT3G20240.1         
TSS from cDNA
TSS information
AT3G20240                        5'->3' (+)
Promoter sequence



 
AT3G20230.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G20240

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+7057011-181
TSS clone peakAclone+7057049-143

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTC+70570007057007-192-185
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAACCGGAT+70568197056828-373-364
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGCGTTTTGA+70569007056908-292-284
 AtREG585GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653 CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-7056756AT3G20230.1
TSS clone peakAclone-7056699AT3G20230.1
TSS cloneCclone-7056698AT3G20230.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTC-70567007056707AT3G20230.1
Y PatchCTTTCTCC-70567227056729AT3G20230.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCGGTTCA-70568197056828AT3G20230.1
 AtREG561ATCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480  CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCAAAACGC-70569007056908AT3G20230.1
 AtREG653TCAAAACG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.