version
PlantPromoterDB promoter information of AT3G20270.1

Summary of Gene (AT3G20270.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G20270  TAIR      NCBI 
Gene model AT3G20270.1  
Description lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 7066779-7067978)

Genome position     
from initiation codon
AT3G20270.2         
TSS from cDNA
TSS information
AT3G20270.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G20270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTC+70670857067095-694-684
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCTTC+70668817066891-898-888
 AtREG421ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAATGGGCTTTTT+70668977066909-882-870
 AtREG386AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589     GGCTTTTT PPDB Motif  PLACE Motif 
REGGAAACGACGTCGTC+70669377066950-842-829
 AtREG576GAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG      PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT     PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG526      ACGTCGTC PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.